                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:124 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.40 kcal/mol
Antiterminator:    Distance from promoter:109 nt. Size=33 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:    Distance from promoter:95 nt.    Size=30 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCACC-TATCGT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCACCGTCGGGGCCGCGCTGTGTATCGTGGCAGTAGGAATGGATATCGGCCCCGGCG
GCGCGCGCCGCCTCCAGGAATTTGGCGCGGGCCTGCGCATAGGTTTCGGAGAAAGGAT
CGGACGCGTGCACattggctcctagataggggttggcaaattcaatcccattctacggaatggttctggaattttttttcgttttcccgct
cgagatataccgtttacaggtgaaatcATG

    BB1171 Gene: BB1171     GI: 33600157     BI number: BB1171     GOG: COG0318     Description: putative acid CoA ligas                      ac                     t  g ga         a        cg a  t      a  a       ta ta       c  t       ta cg        gt        at cg        gc        cg tg        ta        cg cg        ta       |  t gt        gt       c  t g  |       gc       t  c t  |       gc       a  t t  |       gc       a  g at       a  a       cg Cg       t  t       ta A  |       at        ta Cg        gc        at Gc        at        at Ta        ta        at                         tttttcgttttcccgctcgagatataccgtttacaggtgaaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here     ..................................................................................................................