                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACGATCCGCTGCGAGATCCACCAGCCCAGGCCCGCCACCAGCGCCAGCCAGGCCAG
GGCCAGGCCCAGCGTCACGTGGCGCACGATCCGCTGCATGGGCTGTGCGCGCCTGCCT
TGGTTGTGCAACACGTTTTTCGCTCCCCTTTGCGGCCGGCCGCCAAACCGGCTTGTCG
TGGCGTTCGTGGTGTTTCCGGGCGTGGTCTGGAGTATAGGAGGGTTCCATGGCGCGTG
CATgcccgaagcgccctcgtatccatatgttcaaataccccttccccacgcccgcccccttgcgcccgATG

    BB1219 Gene: BB1219     GI: 33600205     BI number: BB1219     GOG: COG0583     Description: LysR-family transcriptional regulato   G T  C C  A GT CG CG T  G A  C GT CG AT CG GC        CC CG       G  T GC       T  T G  |       CG T  |       CG G  |      |  T C  |       GT A  |       CG C  |       GT TG        CG GC        GC C  |      |  A GC        TA AT        GC CG        TA             CGTTTTTCGCTCCCCTTTGCGGCCGGCCGCCAAACCGGCTTGTCGTGGCGTTCGTGGTGTTTCCGGGCGTGGTCTGGAGTATAGGAGGGTTCCATGGCGCGTGCATgcccgaagcgccctcgtatccatatgttcaaataccccttccccacgcccgcccccttgcgcccgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................