                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCTTCACCGCCGGCCTGCACCGCTACGGCCCGATGTGGGTCTATACCAGCCGCGGC
ACCGGCTACTGGGGCCCGCCCAAGCGCCTGGGCGCCCCCTCCGAGATCACCCGGGTGC
GCCTGGTCCGCGCCTGAtccggccccggccgcgcctgtcgcaaacaccccggcacattgtcgcgattgcccgtcgcgggcgcgcgttt
tttgcggcacagtgagtgctgcacccactgcccgcgccgccgcgcctgctccaggccggcgccgccggcgcctccccttcctgccggagacaccccATG

    BB1236 Gene: BB1236     GI: 33600222     BI number: BB1236     GOG: COG2764     Description: putative glyxalas             c           a  a           a  c   T       a  c C  G      c  c C  A       gc G  t       cg C  c       tg Gc        gc Cg        ta Cg       |  c T  c      |  a Gc       |  t        c Gc       |  t      t  g T  c      c  g       gc Cg       c  t       cg Cg        gc        cg |  c       cg        cg Gc        gc        gc Cg        cg       t  g Gc       |  a      t  | Tg       |  t      a  | Gc       |  t       gc Gc        cg        cg Gt        gc        gc Cg        gc        cg                         ttttttgcggcacagtgagtgctgcacccactgcccgcgccgccgcgcctgctccaggccggcgccgccggcgcctccccttcctgccggagacaccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2764 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................