                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-29.70 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-14.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCGGTCAGCAGCGCCAGCGCGGCGGCCGGTAGCAGGCGGGAACGGATCATggcgactcc
ttgcggacaggcggattcgccagcgtagcgccggggccgcaagggcgcagccgggcggcgccgcggcgcgccgccgaaagcgccggcggcgcggcgggcg
ggccgggcaaggccggcgccgggcccgccgggcggccggttgacaaggccatgggcttgcgatgtgatcggcaatgcggcgggcgcggccggccgccggc
ccgccgcgcgattttttccggccttgccaggaggacgccATG

    BB1264 Gene: BB1264     GI: 33600250     BI number: BB1264     GOG: COG2841     Description: conserved hypothetical protei   c t  g a  g gc ta g  a t  t a  g        g gc       g  c cg       c  c |  g       cg gc        gc tg        gc tg        cg cg       g  | gc        cg g  g       gc gc        gc tg        gc |  g       cg |  c       gc a  c       gc cg        cg cg        gc gc        tg             cgattttttccggccttgccaggaggacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2841 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................