Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-24.51 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGCGAGCCCATCGACGAGCCGGTGGTGGGCCATGGGCCGTTCGTCATGAACACCCA
GGCCGAGATCGTGCAGGCCATCGACGACTTCAACCGCGGCGCGTTCGGCCGCATGGGC
TGAgcggccatccccacgagggggggcctgtccccacggggacaggcgcccctctctccgacatttcctgctttacgtggagcaaatacctgacgctg
gcgcggacatctgcgagttactctggcttgccttcgtagcaacctctgccggcgttcatccgccggttttttttatccggccagccATG

    BB1280


Gene: BB1280     GI: 33600266     BI number: BB1280     GOG: NOG10340     Description: putative exported protei


           tt
          c  g
           gc
           gc
          t  |
          c  |
          t  |
          c  |
          a  |
          t  |
          t  |
           gt
           at
           gc
           cg
           gt
           ta
 ca        cg
a  t      t  c
 gc       a  a
 gt       c  a
 cg       a  c
 gc        gc
 cg        gt
g  a      c  c
g  g       gt        ca
t  t       cg       t  t
c  t       gc       t  c
g  a       gc        gc
c  c       tg        cg
 at        cg        gc
 gc        gc        gc
t  t       cg        cg
 cg        at        cg
 cg        gt        gt
                        tttttttatccggccagccATG


    ..................................................................................................................