                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-23.00 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-19.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGAGCTCCGTAAAGTGAAGAACACAGCAAGCATggtggcgcgccgggacggcgcgcacgcgcagtgtgcgtg
gaacgcatcggctcgtcgcgcgagccggtgtttttcttacagcctgctgccgggcgcgtcagtcacgggcaagccggcggatcgccggcctcgtcgtccc
cggggtatcgctgcgccgtgcggcgcaatgccgccaactggcggcggaaggcgcggcgggcaacatgacgagattgtcagaagattgtgcgcgagcgtgg
gaaaccgctgtttataatctcggaccATG

    BB1293 Gene: BB1293     GI: 33600279     BI number: BB1293     GOG: NOG42262     Description: putative lipoprotei             c           g  a            cg            gt            cg            at   g        cg g  a       gc gc        cg cg        gt         g cg        cg       c  c gc       |  g      t  g cg       |  a       gc gc       g  a       cg cg        gc        ta gc        cg        cg |  a      a  c       gc gc       g  a       gc tg        gt        cg gc        gc        tg |  g       cg        at gc        cg        cg Ta        gc        gt                         ttttcttacagcctgctgccgggcgcgtcagtcacgggcaagccggcggatcgccggcctcgtcgtccccggggtatcgctgcgccgtgcggcgcaatgccgccaactggcggcggaaggcgcggcgggcaacatgacgagattgtcagaagattgtgcgcgagcgtgggaaaccgctgtttataatctcggaccATG     ..................................................................................................................