                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-20.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCCCTACGAAACGCACAGCGAACTGGGGCAGGTGGCCGAAACCCTGGTCGACCTGG
CCAAGCGCCTGGATGTGGACGAAATCGTCATGGGCTCGCGCGGGCTGGGCTCGATCTC
GTCGGTCATGCTGGGGTCGGTCGCGACCAAGGTGCTGCACCTGGCCGAGACGCCGGTC
ACGCTGGTCAAGTAGccgccgcgcttgccgtagaatggcgcggcctttttcaccgccgcagccatgaatcgccccaccccgcgcgccgg
gtccgccctgcttcccattgttctgctcctggtcgccATG

    BB1314 Gene: BB1314     GI: 33600300     BI number: BB1314     GOG: COG5006     Description: putative membrane protei   T C  G GC        CA TA       T  A GC       G  G GC        GT A  |       TA AT        CG CG        Gc CG       C  c A  C      A  | GC       C  | CG        Tg G  A       Gc         t C  |       Gc       g  a T  |      C  |      c  g G  |       Cg       c  a G  |       Gc       g  a CG        Cg       t  t TA       A  |       tg GC        Gc        cg G  G       At        gc GC        Gt        cg GC       C  |       gc TG        Cg        cg CG        Gc        cg GT        Gc        gc                         ctttttcaccgccgcagccatgaatcgccccaccccgcgcgccgggtccgccctgcttcccattgttctgctcctggtcgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5006 Predicted permease, DMT superfamily ... can be seen here     ..................................................................................................................