                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:150 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-28.00 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCGCCTGCTCGCCTGAgccctgccggcgccgtccaggcccgccgcccttcggggcgcgcgggcttttttcattggaggcgcggcg
acaaaaaaaggcccccacgctgcgcccgctgtgcgggcttgctgccccccaagggggcttttttgccttggggcggcccggcggcaaaaaagccgggata
aaagcgtcgcgccggggcggcggcgcaaccattacgcccgcacaatggatttatccgcgccggcgtgatttattaacctacttgccaaaattttctttct
tgtttagcctcgaATG

    BB1411 --- BB1412 --- BB1413 --- BB1414 Gene: BB1411     GI: 33600397     BI number: BB1411     GOG: NOG08272     Description: conserved hypothetical protein Gene: BB1412     GI: 33600398     BI number: BB1412     GOG: COG1396     Description: putative DNA-binding protein Gene: BB1413     GI: 33600399     BI number: BB1413     GOG: -------     Description: putative membrane protein Gene: BB1414     GI: 33600400     BI number: BB1414     GOG: COG1495     Description: putative membrane protei            cc           g  c            cg            gc           t  |   c       c  | g  g       gt cg        cg gc        at g  g       cg a  a      c  c g  |       cg gc        cg ta        cg ta        gc a  |       gt c  |      a  | ta       a  | ta       a  | ta       a  | ta       a  | ta       a  | tg       a  | cg       c  | gc       a  | gc        gt gc        cg |  c       gc |  c       gt |  a       cg |  c       gc cg       c  |        a gc        gc       c  a |  t       gc        cg cg       a  c       cg gc        gc        cg cg        gc        cg gc        ta        cg gc        ta        gc                         ttttttgccttggggcggcccggcggcaaaaaagccgggataaaagcgtcgcgccggggcggcggcgcaaccattacgcccgcacaatggatttatccgcgccggcgtgatttattaacctacttgccaaaattttctttcttgtttagcctcgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1396 Predicted transcriptional regulators ... can be seen here [O] COG1495 Disulfide bond formation protein DsbB ... can be seen here     ..................................................................................................................