                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-15.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCACCCAGGCGCTGGCCAACCGCATCACGTTCTTCACCACCATCGCCGGCGCGCGCGC
CGCGGTGGAAGGCATGCAATTCATGCGCCAGGGGCTGGGCCTGCAGGTCTACCCCTTG
CAGGAGCTGCACGCCGGGCTGACCGCGCAGTAAggcggcgcctcgaacgtccgccccatccacggcgccatgccgg
gatggggttttttttttggtgcctgtccccgcggggacaggcaccgccgcacagccaagtccggtatcctggcgcggacatccgtttcccgattccagga
cgacaggcATG

    BB1448 Gene: BB1448     GI: 33600434     BI number: BB1448     GOG: COG1028     Description: probable short chain dehydrogenas             c           t  g           c  a           c  a CG        gc C  C       cg A  G      |  t GC        gc TA        gc         c CG        cg       c  a GT        gc       g  t G  A       gc        cg G  A      |  c       gc Cg       |  c       gc Cg       |  a       cg Gc       |  t      a  | Cg       A  c       cg A  |      A  c       cg Cg        Ta        ta Gc        Gc        at Tg       A  g       cg C  c       Cg        cg Gc        Gc        cg At        Cg        cg Gc        Gc        gt                         tttttttttggtgcctgtccccgcggggacaggcaccgccgcacagccaagtccggtatcctggcgcggacatccgtttcccgattccaggacgacaggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................