                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-15.40 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-28.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGCCTGATGGTCGAGGCCGAGGACGAAGCGCTGGCGCAGGCCAGCGCCCAGAAGCT
GGCCGACAGCCTGGGCGCCTGAgcaaggcccggacctgcccgaaggcccgcctgatggcgggcctttttgttgcgcgggcgacg
caggcatgcaaggccatgactctgtttgtatcaaatggtcaagcggggtcgtatcgccctcggtggggcggcgtaaacttcatagtcacgtaacatatcg
gtcagattactgacatgacgcgcggccacactggcaggacatttaggagtttcgcgcaATG

    BB1463 Gene: BB1463     GI: 33600448     BI number: BB1463     GOG: COG3176     Description: conserved hypothetical protei CA         g C  G      A  c C  A      G  a G  A       Ta CG        Cg GC        Cg AT        Gc CG       |  c CG       |  c GC       |  g GC       |  g |  G      |  a A  A      |  c C  C      |  c       ga G  A      |  t      t  t CG        Cg        cg GC        Gc        cg GC        Gc        gc |  T       Gc        cg |  G      |  g       cg TG       |  a       cg CG        Ta        gc GC        Cg        gc CG        Cg        at GC        Gc        at                         tttgttgcgcgggcgacgcaggcatgcaaggccatgactctgtttgtatcaaatggtcaagcggggtcgtatcgccctcggtggggcggcgtaaacttcatagtcacgtaacatatcggtcagattactgacatgacgcgcggccacactggcaggacatttaggagtttcgcgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3176 Putative hemolysin ... can be seen here     ..................................................................................................................