                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCCTGAGGCAAACCAGCCAACCCACCGAAGCGCAACGGCGCGCCCTGCGCACCCTCG
AGACAGCGCGCCAGCTGATGGCCGAGAGCGGCGCGACCCCGCCCGCGGCCGACCCGGT
ATCGACCGAGGCCGAGCTGGTCGCGTACCTGAACGAACGCTACGCCAGGCCGGTCAAC
CGTTAGggcgcgcgatacaggctgcgcgcggcatgtaacgcgacgatagttttgtattcacggcgttacgagtggaaagtggccgccgggtacact
gctggcgatcgaatttcttcgccttcagccATG

    BB1554 Gene: BB1554     GI: 33600539     BI number: BB1554     GOG: COG0766     Description: Putative UDP-N-acetylglucosamine 1-carboxyvinyltransferas tg a  t c  a        g g  a      t  g gc       g  a cg       a  a gc       g  a cg        cg |  a       at gc        tg cg        tg        ca |  a      |  c      a  c gt        gc       t  t ta        cg       g  g cg        gc        gc |  t       gc        gt gt        cg        cg gt       a  g       cg at       c  |       gc cg       t  |       cg at        tg       c  a ta        at       g  t at        ta        gc gt        gc        tg                         aatttcttcgccttcagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0766 UDP-N-acetylglucosamine enolpyruvyl transferase ... can be seen here     ..................................................................................................................