Gene putatively regulated by attenuation in B_bronchiseptica
Characteristics of the secondary structures
Terminator: Distance to gene:195 nt. Distance to run of Ts=1 nt. Size=33 nt. Delta G=-13.10 kcal/mol
Antiterminator: Size=34 nt. Delta G=-20.00 kcal/mol
Anti-antiterminator: Size=22 nt. Delta G= -8.80 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
GGTCGTGAGCATCGGGCATagggaatgtcggggcaaggcaggactgccggcacgcagccgggaagctggcggggcgccgggcagcg
ccgaaaattgccgatttgttacgaaatctttattattttaccagaccatgccgcggatcccggcgccgggcctggccgggctcggccatcggcagccgtc
ccgacggatgagcggcgccgttgcgtgcgtgcccgcgttgcaggggggtgccgcgccgcgtatgctgggccacccgtctcctgggccaacgtctcttttg
tagggaaacccgctATG
BB1560
Gene: BB1560 GI: 33600545 BI number: BB1560 GOG: NOG10724 Description: putative lipoprotei
aa gg
g g g c
gc c a
gt cg
cg gc
cg cg
gc gc
g | g gc
c c | g | g
a a a g | a
cg cg | a
gc gc | a
gc c | | a
cg a | gt
cg cg gt
| g gc cg
g a gc gc
ta cg gc
cg cg tg
atttgttacgaaatctttattattttaccagaccatgccgcggatcccggcgccgggcctggccgggctcggccatcggcagccgtcccgacggatgagcggcgccgttgcgtgcgtgcccgcgttgcaggggggtgccgcgccgcgtatgctgggccacccgtctcctgggccaacgtctcttttgtagggaaacccgctATG
..................................................................................................................