                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-21.90 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-15.52 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCTGGGGTCACAAGTTCGAATCTTGTAGGGCGGGCCAcagctttcccgcgcattgcggccagaccgaaa
atcccatgcagatcactgatttgcatgggattttttttgcgctttggcgccgtggccgccctgggttgcccaccctgaagataataatggttacttcgag
ttttatttaatggcatattgacgccagtccttcaggcttgccggaggggccggagggcttcgccggggctgcccgcggcggtccgcttccccgatccaat
cgccgtgcggcggcgcgcagtcctgccgcATG

    BB1564 Gene: BB1564     GI: 33600549     BI number: BB1564     GOG: COG0840,COG2206     Description: putative exported protei            cc           t  c           t  g           t  c            cg            gc           |  a           |  t            at            cg           A  c            Cg            Cg            Gc            Gc           |  a           |  g           |  a           |  c           |  c           |  g        c           |  a      a  t           |  a       cg           |  a       ta AT       G  a       at G  C      C  t       gt T  T       Gc        at AT        Gc        cg cG        Gc        gc gT       |  a       ta |  A       At        at |  G       Tg        cg cG        Gc        cg cG       T  |       cg gC        Ta        ta tG        Cg        at cG        Ta        at cG        At        at                         tttttgcgctttggcgccgtggccgccctgggttgcccaccctgaagataataatggttacttcgagttttatttaatggcatattgacgccagtccttcaggcttgccggaggggccggagggcttcgccggggctgcccgcggcggtccgcttccccgatccaatcgccgtgcggcggcgcgcagtcctgccgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here [T] COG2206 HD-GYP domain ... can be seen here     ..................................................................................................................