                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-36.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gccgggcagttttgcgcaacccaatcaggatcagggcggcagccggcgttctgcgcgaacgccttgccgccaaatcgggatcctgccaccgttcgcccaa
gaaaaaaggcacctcggcttgcgcctaagtgcctgttttccaacgaattcgggTGGGGTGGCTGATGGGACTCGAACCCA
CGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACcgcagcaaagaaacg
agattctagcacaaaataaatgacgcatcagccccggcgcttccggcgggcaaatcTTG

    BB1647 Gene: BB1647     GI: 33600632     BI number: BB1647     GOG: COG1502     Description: putative phospholipas   c g  g t  c cg ta ta gc cg gc gc c  | c  |       cc gt       c  a at       g  a cg        cg gc        ta gc        ta cg       g  a gc       c  a gc       c  a |  a      a  a |  a       cg        tg |  a       cg       t  c |  t       gc        cg |  c       ta        gc g  g      c  c       gc a  g      c  |      c  t cg       t  |      t  a ta       a  |      c  a at        gc        cg gc        gt        at gc        gc        cg at        cg        gc cg        tg        gc                         tgttttccaacgaattcgggTGGGGTGGCTGATGGGACTCGAACCCACGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACcgcagcaaagaaacgagattctagcacaaaataaatgacgcatcagccccggcgcttccggcgggcaaatcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1502 Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases and related enzymes ... can be seen here     ..................................................................................................................