                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-33.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGAAGCGCCCCCCACCTACCGACAGGGTTTCGCCCGGCTGTGGCGAGAAATCAACG
GCGACGGTACCTGGGCTTCCAACCCCTGGGTGTGGGTTGTGGAGTTCCACGCCCTGGG
CGCCCCCAATCAGGAGCCCAAGCCGTGAccgccctactcgtcctggcggtgccgctggccgtcgtcatcggcgccggcg
tcggggccgcctccagcctggtacgaaccaggcggcggccgcgcccccgatatttgaattgatcaccgataccccggccctgccggggtttgttttggag
gcgatATG

    BB1662 --- BB1661 --- mutS --- BB1659 Gene: BB1662     GI: 33600647     BI number: BB1662     GOG: -------     Description: phage-related hypothetical protein Gene: BB1661     GI: 33600646     BI number: BB1661     GOG: COG0582     Description: integrase Gene: mutS     GI: 33600645     BI number: BB1660     GOG: COG0249     Description: mismatch repair protein Gene: BB1659     GI: 33600644     BI number: BB1659     GOG: COG2850     Description: conserved hypothetical protei cg a  a ta        aa gc       g  t gc       t  t ta        tg cg        ta cg        at gc       |  c a  |      t  a cg       a  c cg        gc t  c       cg cg       c  a cg       c  t |  c      c  a gc       c  c cg       g  c |  c      c  c        c cg        gc       c  t gc        cg        cg |  c       cg        gc gc        gc        gc gc        gc        cg gc       c  |       cg cg        gc        cg ta        gt        cg gt        cg        at                         ttgttttggaggcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0582 Integrase ... can be seen here [L] COG0249 Mismatch repair ATPase (MutS family) ... can be seen here [S] COG2850 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................