                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCGGCAGCAGCGCGATCTTTTAGATATCAGTTCGTATGCGGCAGAGCTCTGCGAGAA
ATTAAAGAAAGCGCCTGCCAAATAGttgccaaggaaagggaaaaggctcgcttttcgcgggccttttttattggagttcgag
aatgtcaactgccggatcaatcgtcgtcgacctgctggctcggaccggcagtttcgagactgacatggaccgtgccgcccgtactacccgccgggcggca
cgtgaaatggagcagagcgctgagcaggccggatcctcctggacacgtgcctctgcactgATG

    BB1706 --- BB1707 --- BB1708 --- BB1709 --- BB1710 --- BB1711 --- BB1712 --- BB1713 --- BB1714 --- BB1715 Gene: BB1706     GI: 33600691     BI number: BB1706     GOG: COG5281     Description: putative tail component of prophage Gene: BB1707     GI: 33600692     BI number: BB1707     GOG: -------     Description: phage-related hypothetical protein Gene: BB1708     GI: 33600693     BI number: BB1708     GOG: NOG42864     Description: phage-related hypothetical protein Gene: BB1709     GI: 33600694     BI number: BB1709     GOG: -------     Description: phage-related hypothetical protein Gene: BB1710     GI: 33600695     BI number: BB1710     GOG: COG4733     Description: phage-related hypothetical protein Gene: BB1711     GI: 33600696     BI number: BB1711     GOG: -------     Description: phage-related putative exported protein Gene: BB1712     GI: 33600697     BI number: BB1712     GOG: -------     Description: phage-related hypothetical protein Gene: BB1713     GI: 33600698     BI number: BB1713     GOG: -------     Description: phage-related putative membrane protein Gene: BB1714     GI: 33600699     BI number: BB1714     GOG: -------     Description: phage-related hypothetical protein Gene: BB1715     GI: 33600700     BI number: BB1715     GOG: -------     Description: phage-related putative exported protei             g           g  a           a  a AA       a  a G  A       cg AT        cg GT       g  g C  A       ta G  A       ta TA       G  a CG       A  a TA       T  | |  A      A  | |  A      A  | CG       A  | GC        Cg         t |  G       Cg       t  t A  C       Gc       t  c GC       T  t       cg AT       C  |       gc CG       C  |       cg GC        Gc        tg GC        Cg        cg C  A       Gc        gc G  A       At        gc TA        At        at AT        At        at TA        Gt        at                         tttattggagttcgagaatgtcaactgccggatcaatcgtcgtcgacctgctggctcggaccggcagtttcgagactgacatggaccgtgccgcccgtactacccgccgggcggcacgtgaaatggagcagagcgctgagcaggccggatcctcctggacacgtgcctctgcactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5281 Phage-related minor tail protein ... can be seen here [S] COG4733 Phage-related protein, tail component ... can be seen here     ..................................................................................................................