                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-21.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtatatcaacacgttgcgatgcatccggcagctactgctgcatcatgggagtatggccggccagggcgtcgccggtcgtttgctttggtgtggaagacat
aggcaggattgtatcgggccgcccgcgctgtccgccatgcggcaggcgccgggccgccatggtgtcgcgcgatgacgcattgcgcaacatccggtgctgt
gcgccgtttcttccctgtgctcaaatgaatcagccggcggcgcagtgcgcgcacgaggcgcgtccggtcggcggccagcaaccgtacaaggagcaacgcc
ATG

    BB1718 Gene: BB1718     GI: 33600703     BI number: BB1718     GOG: COG3360     Description: conserved hypothetical protei   c a  g gc ta at gt cg gc cg gc c  a ta gc ta gt gc t  c a  |        g cg       t  t cg        cg gt        gc c  |       tg cg        gc gc        gc gt        cg             tttcttccctgtgctcaaatgaatcagccggcggcgcagtgcgcgcacgaggcgcgtccggtcggcggccagcaaccgtacaaggagcaacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3360 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................