                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:180 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-19.70 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G=-26.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttacaGCGCCCGTAGCTCAGTTGGATAGAGTACTTGGCTACGAACCAAGGGGTCGTGGGT
TCGAATCCTGCCGGGCGCGCCAatatgaaaagccgccatgccttgtgcatggcggctttttgctttgggcggcgcgcgcgcttg
cggcgcttgccctgccacgggtttgagggccggccgtatgcccttacacttgccgtacttttcgcagccactttgacttttcgaggtgaaggcggactgc
cgtggcgtgccttgccggcgagtggggcgcggggcggcggcgcgccgcaggagcctATG

    BB1771 Gene: BB1771     GI: 33600756     BI number: BB1771     GOG: COG1846     Description: MarR-family transcriptional regulato   C A  G T  A C  A GC GC TA TA CG A  G T  G G  G AT GC |  G |  T |  G A  G TG AT GT GC TG TA         t G  A      a  g A  T      t  a C  C      a  a T  |      A  a        t C  |      C  a      t  g GC        Cg       c  t AT        Gc        cg TG       C  |       gc |  C       Gc        ta GC        Cg        at CG        Gc        cg CG        Gc        cg CG       G  a       gc GC       C  t       cg CG        Cg        cg GC        Gc        gc                         tttttgctttgggcggcgcgcgcgcttgcggcgcttgccctgccacgggtttgagggccggccgtatgcccttacacttgccgtacttttcgcagccactttgacttttcgaggtgaaggcggactgccgtggcgtgccttgccggcgagtggggcgcggggcggcggcgcgccgcaggagcctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................