Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=20 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=14 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGGTCACCAACGCCGACGTCGCCGAAGGCCTGCGCAAGGCCGGCTTCGAAGCCGTC
GAGAAGTCGCAGGTGCGCATGCCCAATGGCCAGATCAAGGCCGTGGGCGAGTACCCTG
TGCAAGCGGTGCTGCACGCCGACGTCGTTGCCGACGTGGTGGTGCTGGTCGAAGGCGA
AATGGCCTGAttgtccggcatgcctgaaaaaagccggcctggtgccggcttttttttcgagggcggcgcgggccgcgggaggcgcgctaccat
cagcgccattgtttctgctcaggggatgccggtTTG

    BB1918 --- dnaB


Gene: BB1918     GI: 33600903     BI number: BB1918     GOG: NOG09259     Description: hypothetical protein
Gene: dnaB     GI: 33600904     BI number: BB1919     GOG: COG0305     Description: DNA helicas


           gg        cc
          c  g      a  a
          g  a      t  t
 cg        cg       c  c
g  g       cg       g  a
 cg        gc        cg
 gc       g  g       gc
 gc        gc        cg
 cg        cg        gc
 gc        gc        gc
                        attgtttctgctcaggggatgccggtTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0305 Replicative DNA helicase ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -7.12 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTCGGTCACCAACGCCGACGTCGCCGAAGGCCTGCGCAAGGCCGGCTTCGAAGCCGTC
GAGAAGTCGCAGGTGCGCATGCCCAATGGCCAGATCAAGGCCGTGGGCGAGTACCCTG
TGCAAGCGGTGCTGCACGCCGACGTCGTTGCCGACGTGGTGGTGCTGGTCGAAGGCGA
AATGGCCTGAttgtccggcatgcctgaaaaaagccggcctggtgccggcttttttttcgagggcggcgcgggccgcgggaggcgcgctaccat
cagcgccattgtttctgctcaggggatgccggtTTG

    BB1918 --- dnaB


Gene: BB1918     GI: 33600903     BI number: BB1918     GOG: NOG09259     Description: hypothetical protein
Gene: dnaB     GI: 33600904     BI number: BB1919     GOG: COG0305     Description: DNA helicas


 AA
A  T
G  G
 CG
 GC
 GC
 AT
|  G
|  A        g         g
 At       t  a      t  g
 Gt       c  a      c  t
 Cg       c  a       cg
T  t      g  a       gc
 Gc       t  a       gc
 Gc       a  a       cg
 Tg        cg        cg
 Cg        gc        gc
 Gc        gc        at
 Ta        cg        at
 Gt        cg        at
                        tttttcgagggcggcgcgggccgcgggaggcgcgctaccatcagcgccattgtttctgctcaggggatgccggtTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0305 Replicative DNA helicase ... can be seen here

    ..................................................................................................................