                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-17.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCCGTGCCGGCCCCGGCACCAAGGTAGTCTGCCTGGGCAACGTGGCGCAGATCGAC
ACGCCCTACCTGACCGAAGGCAGTTCCGGCCTGACCTTCGTGGTGGACCGCTTCAAGG
GTTGGCCGCATTCCGGCCACGTCACCTTGCAGCGCGGCGAACGCTCCCGCCTGGCCGA
CTACGCCGGCGACGTGCTCTAGcatccacccatgccggaagaaggccctgcggggccttctttttttgcccggcgtgcccggcg
gtgtagcatggtcgcattcccgacttccgcaccactgcaaccATG

    BB1921 Gene: BB1921     GI: 33600906     BI number: BB1921     GOG: COG1995     Description: conserved hypothetical protei   C A  T G  A C  C CG GC GC T  | CG CG        ac GC       c  c CG       c  c C  A       ta C  |       at T  |       cg C  |       Gc G  |      A  c C  |      T  g A  |       Cg A  |       Ta G  |      C  a C  |      G  g G  |      T  a GC       G  a       gc CG       C  g      t  g GT       A  |       cg CG       G  |       cg GC        Cg        cg AT        Gc        gc |  C       Gc        gc |  T      |  c       at |  A      C  t       at CG        Cg        gc Gc        Gc        at Ta        Cg        at                         tttttgcccggcgtgcccggcggtgtagcatggtcgcattcccgacttccgcaccactgcaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1995 Pyridoxal phosphate biosynthesis protein ... can be seen here     ..................................................................................................................