                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=2 nt.   Size=20 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acacagcgttggacaccaagggtggtgccagggttccctgcgttcagggcagggcagcgatgggtttgtagcaagccgtaaggcgtaaagcgcgggcttg
cggtttcgggtcggccacgccaggcgtgttctgatatgagggggccgacggcttgcctgtgggcacatgaccggatcggccatgttgctgccatatgatg
atatacggcgttatgggcaagcatgaataaccaagcattctagtgcatggaattttgtttgtcaagaacctgtcgcaggcgcctgtcacagatcgcttcg
ATG

    BB1957 --- BB1958 --- BB1959 Gene: BB1957     GI: 33600942     BI number: BB1957     GOG: NOG05448     Description: putative lipoprotein Gene: BB1958     GI: 33600943     BI number: BB1958     GOG: COG0628     Description: putative exported protein Gene: BB1959     GI: 33600944     BI number: BB1959     GOG: COG1335     Description: conserved hypothetical protei            ca           g  a           g  g            gc            ta            at            tg            ta           |  a ta       |  t a  c      g  a t  g      c  a a  g       gc gc        gc tg       c  a       ct at       a  a      t  a gt       t  g       tg ta       a  |       at at       t  |       cg tg       a  |       gc a  |       gc       a  a cg        ta        at cg        at        cg gc        gt        cg                         aattttgtttgtcaagaacctgtcgcaggcgcctgtcacagatcgcttcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0628 Predicted permease ... can be seen here [Q] COG1335 Amidases related to nicotinamidase ... can be seen here     ..................................................................................................................