                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-31.81 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctttccgtcgctcgttcgacgcttcccagtccaggagatgtcATGAAGAACAAAGCTCTCATTGCTGTGCTGCTT
GCCATGGCCGCGCTGTCCGCAGGTTGCAATACGGTTGCCGGCGCGGGCAAGGATATCG
AACGAGGTGGCGAAAAAATTCAGGGCGCGGCCCAGAAGTAGcgcgaggcggcgtagccagccgcaccgtg
cgcagccgcctgccgcgatagggcgccaaggcggctttttcattgggcgtgttgatgcataatccgtccgttgcattacttggagcaggagtcgatATG

    BB2058 --- BB2059 --- pyrB Gene: BB2058     GI: 33601041     BI number: BB2058     GOG: -------     Description: putative lipoprotein Gene: BB2059     GI: 33601042     BI number: BB2059     GOG: -------     Description: putative integral membrane protein Gene: pyrB     GI: 33601043     BI number: BB2060     GOG: COG0540     Description: aspartate transcarbamoylas   g a  c t  c g  a cg gc gc cg gc g  a a  c gc cg gt cg Gc |  g       ta A  c      a  g T  a      g  g G  g       cg A  c       gc A  c       cg G  g      |  c A  c      c  c C  c      g  a C  t       ta Cg        cg Gc        cg Gc        gc Cg        cg Gc        cg Cg        gc             tttttcattgggcgtgttgatgcataatccgtccgttgcattacttggagcaggagtcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0540 Aspartate carbamoyltransferase, catalytic chain ... can be seen here     ..................................................................................................................