                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:67 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-17.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGACGGAGGCATCAGGCTGTTGGCCAGGAAGTCTTCCAGCGCAACCCGGAATTCCTG
GAATACGGGAAACGCCGTGAACAGCGACAGCACGACGGCCAGCATCGGCACGATGGCC
AGCACGGTGGTGAACGTCAGGCTCGAGGCCACCTGCAACAGCTTCTGCTCGTCGGCGC
GCTGGCCCGCGAAGCGCACGACCCGGCCCATGCGCGTGAACCATGAGGCGCGCCGTTT
TTCGGGCGGGGCCGCCTGTCCGGCGGCGGCGGATTCGGCGTGAGGCTCCATcaggcgataat
agcagcATG

    BB2106 --- BB2107 --- BB2108 Gene: BB2106     GI: 33601089     BI number: BB2106     GOG: COG3308     Description: putative membrane protein Gene: BB2107     GI: 33601090     BI number: BB2107     GOG: COG0397     Description: conserved hypothetical protein Gene: BB2108     GI: 33601091     BI number: BB2108     GOG: COG0745     Description: probable two-component response regulato   C G  G A  C A  A GC CG        CC |  A      A  A |  C      A  T G  C      G  G C  C      T  A CG       G  G CG        CG GC        GC GC        CG |  C       GC |  A      T  | T  T      A  | CG       C  | GC       C  | CG        CG GC        GC CG        GC GT        CG             TTTTTCGGGCGGGGCCGCCTGTCCGGCGGCGGCGGATTCGGCGTGAGGCTCCATcaggcgataatagcagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3308 Predicted membrane protein ... can be seen here [S] COG0397 Uncharacterized conserved protein ... can be seen here [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here     ..................................................................................................................