                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:144 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-16.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTTTCCTTCAACCGGGCCACGCGCCGCAGGCACGCCGAGGCCGACAGCCCGACGCG
CTCGGCGAGCACGGCGTTGGAGATATCGGCGTCGCGCTGCAAAATCCCAAGAATACGG
TGGTCTATGGCATCAAGTTGCATggttatgcaattttattttgctgttgtccatatgatcgttgattcggctgcctgcaggca
ataaatcgctgcctcattgtgtcgcatccgggctatgctgtcagctgtcatttccgttcattcagccctgttcattcatcgtgccatatctgtcgggtct
cATG

    BB2169 Gene: BB2169     GI: 33601152     BI number: BB2169     GOG: NOG08060     Description: putative membrane protei             G           C  G           A  T           T  G           A  G   A        AT G  T       GC A  A       AT GT       |  A GC        AT TG        CG TG        CG GC       C  C CG        TA        gt GT        AT       g  t GC       |  C       Ta CG       |  A       At A  C      |  A       Cg CG       A  G       Gc GC        AT        Ta AT        AT        Ta G  |       CG        Gt CG        GC        At GC        TA        At                         tattttgctgttgtccatatgatcgttgattcggctgcctgcaggcaataaatcgctgcctcattgtgtcgcatccgggctatgctgtcagctgtcatttccgttcattcagccctgttcattcatcgtgccatatctgtcgggtctcATG     ..................................................................................................................