                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-17.70 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTCTCATCGGATTATCCGGACTTCATCACTAAGTTGAATCGGCTGCATCCCCGATT
TGAAGGCCAGTCCACCCTTGATCTGGAAGACGCTGACAAAGGTTGAacgccacgccctaaaaagca
agccacctccgggtggcttttttattgccctgcccgccccgagcgggcttttttgcgtcagttacaaaaatactgtagcgatgctattgcattgaatctg
tagcgttgctatatttctcccaacgcctcaccgaggcagcgcccgccacccggcgggagggcaaagggagaaagaaATG

    BB2197 --- BB2196 --- BB2195 --- BB2194 --- BB2193 --- BB2192 --- BB2191 --- BB2190 --- BB2189 --- BB2188 --- BB2187 --- BB2186 Gene: BB2197     GI: 33601180     BI number: BB2197     GOG: -------     Description: phage-related hypothetical protein Gene: BB2196     GI: 33601179     BI number: BB2196     GOG: -------     Description: phage-related hypothetical protein Gene: BB2195     GI: 33601178     BI number: BB2195     GOG: -------     Description: phage-related hypothetical protein Gene: BB2194     GI: 33601177     BI number: BB2194     GOG: -------     Description: phage-related hypothetical protein Gene: BB2193     GI: 33601176     BI number: BB2193     GOG: -------     Description: phage-related putative membrane protein Gene: BB2192     GI: 33601175     BI number: BB2192     GOG: COG3723     Description: phage-related DNA recombination protein Gene: BB2191     GI: 33601174     BI number: BB2191     GOG: NOG09295     Description: phage-related exonuclease Gene: BB2190     GI: 33601173     BI number: BB2190     GOG: -------     Description: phage-related hypothetical protein Gene: BB2189     GI: 33601172     BI number: BB2189     GOG: -------     Description: phage-related hypothetical protein Gene: BB2188     GI: 33601171     BI number: BB2188     GOG: NOG15007     Description: phage-related conserved hypothetical protein Gene: BB2187     GI: 33601170     BI number: BB2187     GOG: -------     Description: phage-related hypothetical protein Gene: BB2186     GI: 33601169     BI number: BB2186     GOG: -------     Description: phage-related conserved hypothetical protei            cc           t  g            cg            cg            at   c        cg a  g       cg A  c       gc Gc        at Ta       a  | |  c      c  | Tg       g  | Gc        at Gc        at A  c       at A  t       at A  a       at C  a       ta A  a      c  t G  a      c  t Ta        cg Cg        gc Gc       c  c C  a      a  c A  a      c  t G  g       cg A  |       gc         c A  |      c  c      c  g Gc       a  c      c  a Gc       A  |       cg Ta       G  |       gc C  c      T  |       cg T  c       Tg        cg At        Gc        cg Gc        Gc        gc                         ttttttgcgtcagttacaaaaatactgtagcgatgctattgcattgaatctgtagcgttgctatatttctcccaacgcctcaccgaggcagcgcccgccacccggcgggagggcaaagggagaaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3723 Recombinational DNA repair protein (RecE pathway) ... can be seen here     ..................................................................................................................