                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-15.70 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

taccagtttacgaggagggggctgtctgcccaattcgatgaccatgatTCAGTGCACCGTCGCGCCGGCGGCGTCAGA
GCCTTCCCAGGCCCGGCGGTCGCGCTCGGCGCGCAGCTCGTCGAAAAGGTCCATGACC
GTCTTTTCCGACGGGTCATCGAAGGCACGCCTGGCGATTTCCTGGGCGTGGTTCAGCA
GTTTTTCGGTTTCGGTCATtccgcgactccgttgtatcgatgccgccagtttgcgcggccccgcgtgcaatcgcacgcagctcttt
ttgcagaaggttgaacgaccATG

    BB2203 --- ninB --- BB2205 --- BB2206 --- BB2207 --- BB2208 --- BB2209 --- BB2210 --- BB2211 --- BB2212 Gene: BB2203     GI: 33601187     BI number: BB2203     GOG: -------     Description: phage-related conserved hypothetical protein Gene: ninB     GI: 33601188     BI number: BB2204     GOG: NOG14417     Description: phage-related conserved hypothetical protein Gene: BB2205     GI: 33601189     BI number: BB2205     GOG: NOG40036     Description: phage-related conserved hypothetical protein Gene: BB2206     GI: 33601190     BI number: BB2206     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2207     GI: 33601191     BI number: BB2207     GOG: NOG10166     Description: phage-related conserved hypothetical protein Gene: BB2208     GI: 33601192     BI number: BB2208     GOG: -------     Description: phage-related hypothetical protein Gene: BB2209     GI: 33601193     BI number: BB2209     GOG: -------     Description: phage-related hypothetical protein Gene: BB2210     GI: 33601194     BI number: BB2210     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2211     GI: 33601195     BI number: BB2211     GOG: -------     Description: phage-related hypothetical protein Gene: BB2212     GI: 33601196     BI number: BB2212     GOG: -------     Description: phage-related hypothetical protei ct         t a  c      g  t gc        at cg        cg gt       |  c c  |       cg c  |       gc t  |       cg T  |       cg        at At        gc       a  c Cg       t  c       cg |  t      a  c       gc Ta        gc        ta Gt        cg        gc Gc       |  c       cg Cg        tg        gc Ta        at       c  a T  t       tg       c  | Tg        gc       c  | Gc        ta        cg Gc        ta        gc Cg        gt        gt                         ctttttgcagaaggttgaacgaccATG     ..................................................................................................................