                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-21.50 kcal/mol

                                                                        Nomenclature/Definitions

CGGATCAAGGCCCTGCCGAAGCCGAAAGACATGATCCAGTGTCACCGCTGTGGTGCAC
GCGAGGTCATTGAGACCCGCATTGGCGTGTTCGAGTCTGGCCGCTCGTGGTCGGGCGG
AACGAAGGTACTGCTGTGCGCGCTGTGTTTCGTGCGCGGTGAGCGCGTCGTTTTGAAA
TGAtctgagccattcccgtccggcccgccactgcgcgggccttttttctttcttagccctgccgactgtgtcggcggggcttttgtatttggggctgt
gccctgcaaccgtccagaggacaacaccATG

    BB2218 --- BB2219 --- BB2220 --- BB2221 --- BB2222 --- BB2223 --- BB2224 --- BB2225 --- BB2226 Gene: BB2218     GI: 33601202     BI number: BB2218     GOG: -------     Description: phage-related hypothetical protein Gene: BB2219     GI: 33601203     BI number: BB2219     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2220     GI: 33601204     BI number: BB2220     GOG: -------     Description: phage-related hypothetical protein Gene: BB2221     GI: 33601205     BI number: BB2221     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2222     GI: 33601206     BI number: BB2222     GOG: -------     Description: phage-related hypothetical protein Gene: BB2223     GI: 33601207     BI number: BB2223     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2224     GI: 33601208     BI number: BB2224     GOG: NOG41274     Description: phage-related conserved hypothetical protein Gene: BB2225     GI: 33601209     BI number: BB2225     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2226     GI: 33601210     BI number: BB2226     GOG: -------     Description: phage-related conserved hypothetical protei            g          t  t           cg           at           gc           cg           cg           gc           tg           cg           cg           cg           gc             ttttgtatttggggctgtgccctgcaaccgtccagaggacaacaccATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.60 kcal/mol Antiterminator: Size=44 nt.     Delta G= -8.30 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G=-18.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGATCAAGGCCCTGCCGAAGCCGAAAGACATGATCCAGTGTCACCGCTGTGGTGCAC GCGAGGTCATTGAGACCCGCATTGGCGTGTTCGAGTCTGGCCGCTCGTGGTCGGGCGG AACGAAGGTACTGCTGTGCGCGCTGTGTTTCGTGCGCGGTGAGCGCGTCGTTTTGAAA TGAtctgagccattcccgtccggcccgccactgcgcgggccttttttctttcttagccctgccgactgtgtcggcggggcttttgtatttggggctgt gccctgcaaccgtccagaggacaacaccATG     BB2218 --- BB2219 --- BB2220 --- BB2221 --- BB2222 --- BB2223 --- BB2224 --- BB2225 --- BB2226 Gene: BB2218     GI: 33601202     BI number: BB2218     GOG: -------     Description: phage-related hypothetical protein Gene: BB2219     GI: 33601203     BI number: BB2219     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2220     GI: 33601204     BI number: BB2220     GOG: -------     Description: phage-related hypothetical protein Gene: BB2221     GI: 33601205     BI number: BB2221     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2222     GI: 33601206     BI number: BB2222     GOG: -------     Description: phage-related hypothetical protein Gene: BB2223     GI: 33601207     BI number: BB2223     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2224     GI: 33601208     BI number: BB2224     GOG: NOG41274     Description: phage-related conserved hypothetical protein Gene: BB2225     GI: 33601209     BI number: BB2225     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2226     GI: 33601210     BI number: BB2226     GOG: -------     Description: phage-related conserved hypothetical protei            tg   C       c  a T  G      t  g T  T      A  c TG        Gc GC        Ta TG        At GC        At TG       |  c CG       A  c GT        Gc CG        Tg G  A      T  t CG       T  c       ct GC       T  |      a  g TG        Gc       c  c GC        Cg        cg T  |       Tg        gc CG        Gc        cg GT       C  c       cg T  C       Gc        cg CG        Cg        gc AT        Gc        gc                         ttttttctttcttagccctgccgactgtgtcggcggggcttttgtatttggggctgtgccctgcaaccgtccagaggacaacaccATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.60 kcal/mol Antiterminator: Size=44 nt.     Delta G= -8.30 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G=-18.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGGATCAAGGCCCTGCCGAAGCCGAAAGACATGATCCAGTGTCACCGCTGTGGTGCAC GCGAGGTCATTGAGACCCGCATTGGCGTGTTCGAGTCTGGCCGCTCGTGGTCGGGCGG AACGAAGGTACTGCTGTGCGCGCTGTGTTTCGTGCGCGGTGAGCGCGTCGTTTTGAAA TGAtctgagccattcccgtccggcccgccactgcgcgggccttttttctttcttagccctgccgactgtgtcggcggggcttttgtatttggggctgt gccctgcaaccgtccagaggacaacaccATG     BB2218 --- BB2219 --- BB2220 --- BB2221 --- BB2222 --- BB2223 --- BB2224 --- BB2225 --- BB2226 Gene: BB2218     GI: 33601202     BI number: BB2218     GOG: -------     Description: phage-related hypothetical protein Gene: BB2219     GI: 33601203     BI number: BB2219     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2220     GI: 33601204     BI number: BB2220     GOG: -------     Description: phage-related hypothetical protein Gene: BB2221     GI: 33601205     BI number: BB2221     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2222     GI: 33601206     BI number: BB2222     GOG: -------     Description: phage-related hypothetical protein Gene: BB2223     GI: 33601207     BI number: BB2223     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2224     GI: 33601208     BI number: BB2224     GOG: NOG41274     Description: phage-related conserved hypothetical protein Gene: BB2225     GI: 33601209     BI number: BB2225     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2226     GI: 33601210     BI number: BB2226     GOG: -------     Description: phage-related conserved hypothetical protei TG G  T T  T       tc C  T      A  t GC       G  g CG       T  a GT        Ag CG        Ac GC        Ac TG        Ga GC       |  t TG       T  t CG        Tc GT        Tc |  G      T  c TA       G  g       ct CG       C  |      a  g A  C       Tt       c  c TG        Gc        cg GC        Cc        gc G  G       Gg        cg A  |      C  g       cg AT        Gc        cg GC        Ac        gc CG        Gc        gc                         ttttttctttcttagccctgccgactgtgtcggcggggcttttgtatttggggctgtgccctgcaaccgtccagaggacaacaccATG     ..................................................................................................................