                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-19.10 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-15.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTATGTAGCCAAGAAGCGGAAGCTGCACGAAGGATGCTCGATCTGAagattcggcgtatgccgatg
gcccgtaagggcgcaactggaacccgccacatggcggttttttattgccctctgggcttcgatgaggggccgttggccccctaaggaactatcatcagcg
caatattccccaacggcaccgtcttctcggtatctactggattgggtgcggctgttgctgtttctgcaattactaatgccaatcctgccgtcgccagcgc
gacgagtccgccgaaggcaggcacgatcctgatcATG

    BB2227 --- BB2228 --- BB2229 --- BB2230 --- BB2231 --- BB2232 --- BB2233 --- BB2234 --- BB2235 Gene: BB2227     GI: 33601211     BI number: BB2227     GOG: NOG14083     Description: phage-related conserved hypothetical protein Gene: BB2228     GI: 33601212     BI number: BB2228     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2229     GI: 33601213     BI number: BB2229     GOG: NOG39315     Description: phage-related conserved hypothetical protein Gene: BB2230     GI: 33601214     BI number: BB2230     GOG: COG5281     Description: putative phage tail protein Gene: BB2231     GI: 33601215     BI number: BB2231     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2232     GI: 33601216     BI number: BB2232     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2233     GI: 33601217     BI number: BB2233     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BB2234     GI: 33601218     BI number: BB2234     GOG: COG4733     Description: phage-related conserved hypothetical protein Gene: BB2235     GI: 33601219     BI number: BB2235     GOG: -------     Description: phage-related hypothetical protei GA T  a Cg Ta At Gt C  c Tg Cg        ta Gc       g  a Tg        cg At        cg G  a       cg G  t       gc A  g      |  g A  c       gc Gc        ta Cg       |  a A  a      a  c C  t       gt        ca G  |       cg       a  t Tg        cg        cg Cg       g  a       cg Gc       t  a       gc A  |      a  c      c  | A  |      t  c       cg Gc        gc        cg Gc        cg        at Cg        gc        at Gt        gc        gt                         tttattgccctctgggcttcgatgaggggccgttggccccctaaggaactatcatcagcgcaatattccccaacggcaccgtcttctcggtatctactggattgggtgcggctgttgctgtttctgcaattactaatgccaatcctgccgtcgccagcgcgacgagtccgccgaaggcaggcacgatcctgatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5281 Phage-related minor tail protein ... can be seen here [S] COG4733 Phage-related protein, tail component ... can be seen here     ..................................................................................................................