                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGGCGTGGTCGAGCGCCGCCAGTTGCAGGCGTTCCTTGTCGCCGAACAGTACTTGC
AGATTGCTTTTCCCTACTTCGGCCCGCTCGGCGACCTGGCCGAAGGTGATGCCGTCCA
GTCCCTCGATGGAGAGGAGTTTGACGGCTTCGTCCAGGACGCGTGCGCGCGCGCGTTC
GCCGCGCAGCCGGCGGCCGTCGACGGTGGGGGCGGGGGCAGGTTGAGTCATGGCAGGG
TTCGGCGTATTTGCGCGGACGGGGTTTTTCATCATACTATAAATACGATCGTACATat
atttataaggATG

    BB2330 Gene: BB2330     GI: 33601312     BI number: BB2330     GOG: COG0477     Description: probable membrane efflux protei             T           G  T           G  G           A  A            CG            GT   G        GC G  T      G  A C  G      G  T A  G      G  G G  G       CG CG        GC TG       |  A GC       |  G       AT CG       |  G      T  T CG       G  G       GT G  G       GT        CG G  G       GT        GC CG        GC       |  G GC        TG        GC G  A      G  G       CG CG        GC        TG CG        CG        TA GT        AT        GC                         GGGGTTTTTCATCATACTATAAATACGATCGTACATatatttataaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................