                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACACCGAGTTGAACGCGGTGCTCCAGCAGCCGGATGTGCAGACCCGCATCCGCGAGC
TGGGCGCCGAGCCGGCCCAGCCCGGTCCGCCGGCGCAATTCCAGCAGTTCGTCGATGC
CGAACTGGCCAAGTACGGCAAGGTCATCAAGACGGCGGGCATCGCTCCCGAGTAAtgcc
aggcggttcccgcccggccgcctttttctcccccaaccggttttcagcccgctggcgccttgcgccgcgcgggccgggacagtgcagcctttttttcgca
acaacgcatcaatcaaaggaagatcATG

    BB2346 --- BB2347 --- BB2348 --- BB2349 --- BB2350 --- gabG Gene: BB2346     GI: 33601328     BI number: BB2346     GOG: COG1804     Description: putative acyl-CoA transferases/carnitine dehydratase Gene: BB2347     GI: 33601329     BI number: BB2347     GOG: COG0183     Description: conserved hypothetical protein Gene: BB2348     GI: 33601330     BI number: BB2348     GOG: COG1545     Description: conserved hypothetical protein Gene: BB2349     GI: 33601331     BI number: BB2349     GOG: COG3618     Description: putative 2-pyrone-4,6-dicarboxylic acid hydrolase Gene: BB2350     GI: 33601332     BI number: BB2350     GOG: COG2079     Description: conserved hypothetical protein Gene: gabG     GI: 33601333     BI number: BB2351     GOG: COG1012     Description: succinate-semialdehyde dehydrogenase [NADP+ CC C  G TA CG G  T C  A TA At Cg         t Gc       t  c Gc        gc |  a       gc G  g       cg Cg        gc Gc        gc G  g      a  c Cg        cg At        cg Gt        gc             cgcctttttctcccccaaccggttttcagcccgctggcgccttgcgccgcgcgggccgggacagtgcagcctttttttcgcaacaacgcatcaatcaaaggaagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here [I] COG0183 Acetyl-CoA acetyltransferase ... can be seen here [R] COG1545 Predicted nucleic-acid-binding protein containing a Zn-ribbon ... can be seen here [R] COG3618 Predicted metal-dependent hydrolase of the TIM-barrel fold ... can be seen here [R] COG2079 Uncharacterized protein involved in propionate catabolism ... can be seen here [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................