                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-27.80 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGAGCAGGCGCAGCGCCTGGCCGAGGCGGTCGCGGTGTTCAAGATCAATACCGGCGA
AGTGATCGAAGTGCCGGCGCACCAATTGTCCGGCTACGCGGCGCCCCTGGTCGCGCAG
TCCTGAccggcaccccgacgccgcggccggctggccgcggtccgggccatccgtccgccagggcgggaaagcggcgatccgccgcggccagcgccg
cgccggatcgtctttttacaggcagcggccgcgcgggcggcccgcatgtccgagatgtgtagttcagcagttccacaggagactggcaGTG

    BB2575 Gene: BB2575     GI: 33601552     BI number: BB2575     GOG: COG0840,COG2202     Description: methyl-accepting chemotaxis protei                      ag cc                 c  c g  a                 cg cg                  gc cg                  gc tg                  cg gc                  gc cg                  cg cg                 c  c tg                  gc a  a        t        cg c  a      a  c       cg c  a       gc        ta g  g       cg        at g  |       gc        gc gc        gc        cg cg        cg        gt cg        gc        gc                         tttttacaggcagcggccgcgcgggcggcccgcatgtccgagatgtgtagttcagcagttccacaggagactggcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here [T] COG2202 FOG: PAS/PAC domain ... can be seen here     ..................................................................................................................