Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-26.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgcggggacaggcacccgccaactcctgtgcctgtccccgcatggagacaggcacccgccaactcctgtgcctgtccccgcatggggactggcgcccgcc
aacgtctcggtgcctgtccccacagggaacaggcacccgggcctccctgttcctgctcctccacctgatcacgtgccgcccaccggggcggcattttttt
gctcggggttttccctgaaattctcataaattgagaatgaattctgaaaaaatgggaaaaactgaataatctgcgcacgcaatatcaaggaacgatcgac
ATG

    BB2641


Gene: BB2641     GI: 33601618     BI number: BB2641     GOG: COG1414     Description: probable transcriptional regulato


           cc
          t  t
          c  c
 ac        gc
c  a       ta
 cg       |  c
 cg       |  c
 cg       c  t
|  a       cg
 ta        ta
 gc       t  t
 ta        gc
 cg        ta        cc
 cg       |  c      a  g
 gc       c  g       cg
 ta       c  t       cg
 gc       c  g       cg
 gc       t  c       gc
c  c      c  c       cg
 tg        cg        cg
 cg        gc        gc
 tg        gc        ta
 gc        gc        gt
                        ttttttgctcggggttttccctgaaattctcataaattgagaatgaattctgaaaaaatgggaaaaactgaataatctgcgcacgcaatatcaaggaacgatcgacATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG1414 Transcriptional regulator ... can be seen here

    ..................................................................................................................