                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:38 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.29 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-13.83 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGACCTGGAGGCGATCCGCGCCGCCGGCTACGCGGTCAGCGACAGCGAGGTCGAC
GCCGGCGTGTGGGGCTGCAGCGCGCCGGTGTTCGAGCGGCCGCACCAGGCAGCCGGCT
CGGTCACCCTGATGGCGCCTTCCACGCGCGTGGCCGAACGCACCGCGAACCTGATCAA
CCTGACGCTGGCGGCCGCCAAACGCATTTCCAGCCGCCTGCAGCATTCCTGAcgtatccct
gtggccgtatccatccatacggttttcttcactccaatgccgtacccatcaccaaaggaagcatcATG

    BB2642 --- BB2643 --- glnQ --- BB2645 Gene: BB2642     GI: 33601619     BI number: BB2642     GOG: COG0834     Description: putative glutamine-binding periplasmic protein precursor Gene: BB2643     GI: 33601620     BI number: BB2643     GOG: COG0765     Description: glutamine transport system permease Gene: glnQ     GI: 33601621     BI number: BB2644     GOG: COG1126     Description: glutamine transport ATP-binding protein Gene: BB2645     GI: 33601622     BI number: BB2645     GOG: COG0010     Description: probable arginas   G C  C A  A A  T       GA A  T      T  c C  T      C  g C  C      C  t G  C      T  a C  A      T  t CG       A  c GC       C  c GC        Gc CG        At        at GC        Cg       c  c GC        Gt       c  c T  T      T  |       ta CG        Cg        at GC        Cg        ta C  A       Gc        gc A  G      C  c       cg GC        Cg        cg TA        Gt        gt                         tttcttcactccaatgccgtacccatcaccaaaggaagcatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here [E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here     ..................................................................................................................