                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-19.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-19.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGGGCTGGCCGGCCTGAACATCGTCGCCATCGACGTCAATACGGTCAGCCCGCCGC
ACGACGTCAATGGGACCACGGCATCGCTGGCGGCCGCGCTGATGGTCGAAGGCCTGGT
GCTGCTGTGCAAGCGCCTGGGGCTGGACCATCCCGACCCGGCGCCCGACTTCGCCGCC
ATGTACGCGCGCTGAgcgcggggccgcccgcgcggcccgtgttttccctagtgcccggcggcgccgttcgccaataagattcggactta
ttgaataagtacgaacttattagccaagggaaaacctATG

    BB2706 --- BB2705 --- BB2704 --- BB2703 --- BB2702 --- BB2701 Gene: BB2706     GI: 33601683     BI number: BB2706     GOG: COG1638     Description: Putative secreted protein Gene: BB2705     GI: 33601682     BI number: BB2705     GOG: NOG38912     Description: Putative membrane protein Gene: BB2704     GI: 33601681     BI number: BB2704     GOG: COG1593     Description: Putative membrane protein Gene: BB2703     GI: 33601680     BI number: BB2703     GOG: COG2188     Description: Putative transcriptional regulator Gene: BB2702     GI: 33601679     BI number: BB2702     GOG: COG0412     Description: carboxymethylenebutenolidase Gene: BB2701     GI: 33601678     BI number: BB2701     GOG: COG1028     Description: Putative dehydrogenas CA C  T A  C GC GC         G TG       T  T C  A      A  A G  |      C  C GC        CG GC        GC GC        CG T  |      |  C CG        CG CG        GC GC       C  T CG        TG GC        TA |  C       Cg |  C      |  c |  G      A  g |  A       Gc A  C       Cg        cg A  T       Cg       c  c C  T       Cg        cg GC       |  g       gc TG       |  c       cg GC        Gc        cg T  C       Cg        gc CG        Gc        gc GC        Gc        gc                         gtgttttccctagtgcccggcggcgccgttcgccaataagattcggacttattgaataagtacgaacttattagccaagggaaaacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1638 TRAP-type C4-dicarboxylate transport system, periplasmic component ... can be seen here [G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here [K] COG2188 Transcriptional regulators ... can be seen here [Q] COG0412 Dienelactone hydrolase and related enzymes ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................