Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-20.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATAAACAGGGATGGTTGGAGGAATGCCATccagcgtaccaccagcccggcgtgcgtgcgcgctcatgggctgcggaa
atcacttccgtgttttatttaatatatttaatatcaacaagttaagtatattttttaatcttgattatttaaagtgacttctaaacaaatggtagcccgg
acgagccgggctgcggcgccttgcgccgcagcccatgggagcgcgcaaggagaattatgctgatgaacgcataattttcagattaactgctaaaatatgc
taccgatcgcataaattaagacGTG

    BB2721 --- BB2720


Gene: BB2721     GI: 33601698     BI number: BB2721     GOG: -------     Description: Putative transcriptional regulator
Gene: BB2720     GI: 33601697     BI number: BB2720     GOG: COG3550     Description: Conserved hypothetical protei



 gt
c  g
 gc
 tg
 gc
 cg
 gc
 gt
|  c        c
|  a      t  a
|  t      a  c
 cg        at
 cg        at
 cg        gc
 gc        gc
 at        cg
 cg        gt
c  c      t  |
a  |       cg
 cg        gt
 cg        gt
            ttatttaatatatttaatatcaacaagttaagtatattttttaatcttgattatttaaagtgacttctaaacaaatggtagcccggacgagccgggctgcggcgccttgcgccgcagcccatgggagcgcgcaaggagaattatgctgatgaacgcataattttcagattaactgctaaaatatgctaccgatcgcataaattaagacGTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3550 Uncharacterized protein related to capsule biosynthesis enzymes ... can be seen here

    ..................................................................................................................