                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCGGCAGCCCGATCTTGATGGTCTGCGCCTGGGCCGCGCTGGCGGCGCACCAGAGCG
CTGCCGCCAGCAGGCCCGAGGCGCGCCATGGGGTTCGCATGGACATtgatgtctcctggtcagatt
ggatcccgcacgatccgttgtttatcatttgataactatcgtacaggccattcggcttgtcaattttttcttcgccggggaaaacccttggcgtcgtttt
ctttccattcgcttgcgcagcgggaaatcgatctctattatttatcactcgattacttgaatcaaggaggcgccacATG

    BB2754 --- BB2753 Gene: BB2754     GI: 33601730     BI number: BB2754     GOG: NOG25105     Description: putative dioxygenase Gene: BB2753     GI: 33601729     BI number: BB2753     GOG: COG0654     Description: putative monooxygenas             a   c       a  a g  c      a  c c  g       gc tg        gc tg        gt cg        gt ta        cg ta        cg ta        gc ta        cg             tcgttttctttccattcgcttgcgcagcgggaaatcgatctctattatttatcactcgattacttgaatcaaggaggcgccacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [HC] COG0654 2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:104 nt.     Distance to run of Ts=2 nt.   Size=18 nt.     Delta G= -9.10 kcal/mol Antiterminator: Size=42 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:   Size=35 nt.     Delta G= -6.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACCGGCAGCCCGATCTTGATGGTCTGCGCCTGGGCCGCGCTGGCGGCGCACCAGAGCG CTGCCGCCAGCAGGCCCGAGGCGCGCCATGGGGTTCGCATGGACATtgatgtctcctggtcagatt ggatcccgcacgatccgttgtttatcatttgataactatcgtacaggccattcggcttgtcaattttttcttcgccggggaaaacccttggcgtcgtttt ctttccattcgcttgcgcagcgggaaatcgatctctattatttatcactcgattacttgaatcaaggaggcgccacATG     BB2754 --- BB2753 Gene: BB2754     GI: 33601730     BI number: BB2754     GOG: NOG25105     Description: putative dioxygenase Gene: BB2753     GI: 33601729     BI number: BB2753     GOG: COG0654     Description: putative monooxygenas            ca           t  t           a  t gc       t  t c  a       tg c  c       ta cg        gt ta        ta at        ta gc        gc gc       c  t tg       c  | |  t       ta |  t       at        tt tg        gc       a  c at        cg        cg gt        at        cg at       |  a       gc c  |      c  c       gt ta       g  a       at gt        cg        cg gc        cg        at                         caattttttcttcgccggggaaaacccttggcgtcgttttctttccattcgcttgcgcagcgggaaatcgatctctattatttatcactcgattacttgaatcaaggaggcgccacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [HC] COG0654 2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases ... can be seen here     ..................................................................................................................