                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGAAGGGCACGACCAGGGTCACGGGCTTGGCGGGGAACGTCTCGGCGGCCGCCGGCG
CGGCCGGGCCCAGGGCCAGGCTGGCGGTGGCGGCCAGCGCCAGCACGGCGCGCAGCGT
CATGGTCAAAGCGGGCGAACTCGTCATgtctcgtctcctgtgtctcttgtggcaatgaggcctcgcatgggccgatgggc
ttatttcaccgcatcggattaaataagtaaaagaacaatattggataaattgacaagcattgcttgttaatatgaatgcctgtttcccccccggccggcc
gaccATG

    BB2780 Gene: BB2780     GI: 33601756     BI number: BB2780     GOG: COG0583     Description: Putative LysR-family transcriptional regulato   T G  C       tt C  A      c  g T  T      t  t Cg        cg At        tg |  c       gc At        ta         c Gc       g  a      g  a Cg       t  t      c  t Gt       c  |       tg Gc        cg        cg Gt        ta        cg C  c       cg        gc Gc        tg        gc At        gc       a  g A  g      c  c      g  a At       t  t      t  t Cg       c  c      a  g T  t       tg       a  g Gc        gc        cg Gt        Ta        gc                         ttatttcaccgcatcggattaaataagtaaaagaacaatattggataaattgacaagcattgcttgttaatatgaatgcctgtttcccccccggccggccgaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................