                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-18.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCACGCCGCGACGAGACGCCCGCGCCCAGAAAGCCGCGGCCGCGCGTAGAGCAGG
CCGACGGCAGTCCGGGCGAGTCCGGCGCCATCGCCAACCCCATGCCAGGGCTGAGCCC
GCAGAACACGCCGGGCATGGATCGCTGGTCCGACAACGATTTCGAGGCGGTCTGGCGG
CGGGCCACGCGGGAGCTGTGAcagggaccgcaacggccctgccgcggggcggcacgcgacttgcgcactgcggccggcgagcgtt
cgccacctcggcggcgccggcattttctgcaaggagacgtcATG

    BB2854 Gene: BB2854     GI: 33601830     BI number: BB2854     GOG: COG4575     Description: conserved hypothetical protei tg c  c a  g cg gc |  c        c |  g      c  t cg       a  c gc        cg tg        cg ta        gc cg        cg a  |       tg gc       t  | cg       g  | gt       c  | c  t      g  | a  c      a  | cg        gc gc        cg gc        gc c  a       gc gc        cg gc        cg gt        gc             attttctgcaaggagacgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4575 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................