                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-22.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-20.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-28.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAACACCGGCGGCTGGGCCCTGGAGCTGCAGGGCATGTTCCTGTTCGGCGCGCTCGC
CCTGGCCTTCATGGGCGCGGGCCGCTTCAGCCTGGCCGGGTCGGGCGGTCGCTGGAAC
TGAgcgccgcgccgccgcgccgcgatcgcagggccgcctcgggcggccctgtttttttggacgcttggtaatcaactgtcacgcttgttgtgtttcca
acccgttacgctggcgaaccccaaggccgaaacgacggcctaatcctgacatcgggatttatggacgccgctcgcggcggattgccATG

    BB2880 --- BB2881 Gene: BB2880     GI: 33601856     BI number: BB2880     GOG: COG0532     Description: putative membrane protein Gene: BB2881     GI: 33601857     BI number: BB2881     GOG: COG1225     Description: putative bacterioferritin comigratory protei   G G  T GC CG CG G  G GC TG        gc CG       c  c |  T       cg |  C       gc CG        cg GC        gc AT       c  c CG        cg TG        gc TA        cg |  A      |  a C  C      |  t        c GT       g  c      t  g CG       A  g       cg |  A       Gc        cg Cg        Ta        gc Gc        Cg        cg |  g      A  g       cg Gc       A  g       gc Gc        Gc        gc Cg        Gc        gc Gc       T  |       at Cg        Cg        cg Gc        Gc        gt                         ttttttggacgcttggtaatcaactgtcacgcttgttgtgtttccaacccgttacgctggcgaaccccaaggccgaaacgacggcctaatcctgacatcgggatttatggacgccgctcgcggcggattgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0532 Translation initiation factor 2 (IF-2; GTPase) ... can be seen here [O] COG1225 Peroxiredoxin ... can be seen here     ..................................................................................................................