                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGGCAAACAGCAGGGTCATGACCGGCGCTCCGAGCATCACGCCCACCGCGTAGGC
CGAGATCAGCATGCCCGCGCTGGGAATGCTTACCTGCACACCGTCGGCGATGACGGGC
AGCAGCCCCATCGGCGTGAACTCCGTGGTGCCGATGGCGAATGCGCCGGTGGCCAGGG
CAAACAATGCGGCCGAGGATTTCATcgccgcttctccttgaaaaagtccaatggcgacagtgtgccgggtttatatttgcgg
attaagctctgtatgaaccaaattcttttgatttgaattcaacaATG

    BB2944 Gene: BB2944     GI: 33601920     BI number: BB2944     GOG: COG0583     Description: probable LysR-family transcriptional regulato ag c  t a  g gt cg gc gc t  | a  | a  |        t cg       a  t cg       g  a t  g      g  a g  t       cg at        gc at       |  t |  a      t  c |  t      t  t a  a       tg at        at at        ta gt        at tg        tg t  c       ta cg        ta cg        gc ta        gc             aaattcttttgatttgaattcaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................