                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-36.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCAGACGCTGTACGCCCAGGCCAACTACGAGTACCCGGTGCGCGCCGGCGTCAAGC
TGGACGCGGTGGTGGCCAGCTTCGGCCCGCTGAAGGTCGATACCCTGCCCGTGGCCGA
GATCGCCAAGTACCGCAAGCAGGCCAGCGAACTGGTCGACAAGGTGGGCTTCGACAAC
TGAgccgcgctacactcacgcccgccacgccattgcggcggcgcgggcgttgcctggcgcacggcatgaactgccttgtttgtcggcaaagcggccat
ccggccgctttgcatttttccccgtagcATG

    BB2947 --- BB2948 Gene: BB2947     GI: 33601923     BI number: BB2947     GOG: COG1178     Description: putative inner membrane component of binding-protein-dependent transport system Gene: BB2948     GI: 33601924     BI number: BB2948     GOG: COG3842     Description: probable ATP-binding component of ABC transporte   t t  g a  c cg cg gc cg a  g c  c cg gc cg cg         a cg       g  a gc       t  c cg        at at        cg c  t       gc t  g       gc c  c      c  t a  c       at        tc c  |       cg       a  c at        gt        cg tg       |  t       cg cg       |  t       gc gc        cg        gc cg        gt        cg gc        gc        gc |  a      t  |       at |  c       cg        at cg        cg        at cg        gc        cg gc        ta        gc                         atttttccccgtagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1178 ABC-type Fe3+ transport system, permease component ... can be seen here [E] COG3842 ABC-type spermidine/putrescine transport systems, ATPase components ... can be seen here     ..................................................................................................................