Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.47 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-12.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGGTGTCGGTGGCGACCACCAGTTCCTTGTCCTGGGCCGACGCCGTGGACACGGCGC
CCAGCAGGGCCGCCGACGCGCCGATCAGTACGGCCGCAACTTTCGCTTTGATCATggaa
ctctcctcttggggtctgctcaggccccagccatttgttgtaaggggctaccatctccgagtccgtgccgcatgggtaatccggcgcggacctgcggatc
atcttaacgcatacgtcccccgccgccatccccccgcgggtcattacaatcaaaccagaagcgacccacgacaggagcctgccATG

    BB2977


Gene: BB2977     GI: 33601953     BI number: BB2977     GOG: NOG43341     Description: conserved hypothetical protei


           ct
          a  c
           at
           gc
           gc
  A       T  t
C  G      A  c
T  T      C  |
A  A      T  |
 GC       A  |
 CG       G  |
 CG       T  |
|  C      T  |
 GC       T  |
 CG       C  |
 GC       G  |
C  A      C  |
A  A      T  |
G  C      T  |       ct
C  T      T  |      g  c
C  T      C  |       ta
G  T       At        cg
C  C       At        tg
 CG        Cg        gc
 GC       G  g       gc
 GT        Cg        gc
 GT        Cg        gc
 AT        Gt        ta
 CG        Gc        tg
                        ccatttgttgtaaggggctaccatctccgagtccgtgccgcatgggtaatccggcgcggacctgcggatcatcttaacgcatacgtcccccgccgccatccccccgcgggtcattacaatcaaaccagaagcgacccacgacaggagcctgccATG


    ..................................................................................................................