                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-21.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTGCCCCGCTCGAACAGCAGTTCGCCCAGGTCGTTCTCGAGCGCGGCAATGCGCCC
CGAGATGGCGGCCTGGGTCAGGTGCAGCTTGCCCGCGGCGGCCTTGAAGCTGCGCAGC
TGGGCGACCCAGATAAAGGTTTCGAGAAAGCGGATATTCATggcgttccccgtgcgcgagtcgcggcggc
cgggttgcgcgggtaatccccagtgcgccggccgggcgttgctgtgtgttttttgttgatgaaatatagataaattattagtatttcgtctacaagaact
ttcggccacccgtcATG

    BB2979 Gene: BB2979     GI: 33601955     BI number: BB2979     GOG: COG5631     Description: conserved hypothetical protei tc g  g a  c g  g cg gc cg g  g        a t  c      a  t gc       t  c cg        gc cg        gc cg        gc c  t      |  a t  t       cg         c tg        gt       g  c gc        cg       g  g cg        gc        cg gc        tg        cg g  |      t  |       gc T  |      g  |       cg A  |       gc       |  t Cg        gc        gt Tg        cg        tg Tg        cg        gc At        gc        at Ta        gc        cg                         tgtgttttttgttgatgaaatatagataaattattagtatttcgtctacaagaactttcggccacccgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG5631 Predicted transcription regulator, contains HTH domain (MarR family) ... can be seen here     ..................................................................................................................