Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-24.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-23.74 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCGCGTGCCCGTATCCGGTCAAGGGCAAGATGGTGCTGGTGCAGCCTACCGACGC
CGACCGGGCGTTGCTGAAGAAAGTGACCGAAGAGGCGGTGCTGCCCAAGTGGGCCGCC
CGGTGCTCGGCGCAGTGCGTCAGCGACTTCAACGCCACCATCGGCAAGACGCTGGGTC
TGGTCGCCAAGAAGTAAgtccggacgcgggccggccggcccgccccaatgctgcaacgcgcgccgcggcccggtcgcggcgcgcctgg
tttttcgccaccgcgggcatgcccgcagaggttcattcATG

    BB3001 --- BB3000 --- BB2999 --- BB2998 --- BB2997


Gene: BB3001     GI: 33601977     BI number: BB3001     GOG: -------     Description: hypothetical protein
Gene: BB3000     GI: 33601976     BI number: BB3000     GOG: COG1593     Description: putative membrane protein
Gene: BB2999     GI: 33601975     BI number: BB2999     GOG: NOG48099     Description: hypothetical protein
Gene: BB2998     GI: 33601974     BI number: BB2998     GOG: COG0154     Description: putative amidase
Gene: BB2997     GI: 33601973     BI number: BB2997     GOG: COG4336     Description: conserved hypothetical protei


           gc
          t  t
          a  g
          a  c
          c  a
          c  a
          c  c
           cg
           gc
           cg
          c  c        c
           cg       c  g
           gc        cg
           gc        gt
           cg        gc
 gc       c  |       cg
g  c      g  |       gc
 cg        gc        cg
 cg        cg        cg
 gc        cg        gc
 gc        gc        cg
 gc        gc        gc
 cg        gc        cg
 gc        cg        gc
                        ctggtttttcgccaccgcgggcatgcccgcagaggttcattcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here
[J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here
[S] COG4336 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................