                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-24.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-23.74 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCGCGTGCCCGTATCCGGTCAAGGGCAAGATGGTGCTGGTGCAGCCTACCGACGC
CGACCGGGCGTTGCTGAAGAAAGTGACCGAAGAGGCGGTGCTGCCCAAGTGGGCCGCC
CGGTGCTCGGCGCAGTGCGTCAGCGACTTCAACGCCACCATCGGCAAGACGCTGGGTC
TGGTCGCCAAGAAGTAAgtccggacgcgggccggccggcccgccccaatgctgcaacgcgcgccgcggcccggtcgcggcgcgcctgg
tttttcgccaccgcgggcatgcccgcagaggttcattcATG

    BB3001 --- BB3000 --- BB2999 --- BB2998 --- BB2997 Gene: BB3001     GI: 33601977     BI number: BB3001     GOG: -------     Description: hypothetical protein Gene: BB3000     GI: 33601976     BI number: BB3000     GOG: COG1593     Description: putative membrane protein Gene: BB2999     GI: 33601975     BI number: BB2999     GOG: NOG48099     Description: hypothetical protein Gene: BB2998     GI: 33601974     BI number: BB2998     GOG: COG0154     Description: putative amidase Gene: BB2997     GI: 33601973     BI number: BB2997     GOG: COG4336     Description: conserved hypothetical protei            gc           t  t           a  g           a  c           c  a           c  a           c  c            cg            gc            cg           c  c        c            cg       c  g            gc        cg            gc        gt            cg        gc gc       c  |       cg g  c      g  |       gc cg        gc        cg cg        cg        cg gc        cg        gc gc        gc        cg gc        gc        gc cg        gc        cg gc        cg        gc                         ctggtttttcgccaccgcgggcatgcccgcagaggttcattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here [J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here [S] COG4336 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................