                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agtggactacaaggaccagctttttgttactgcggtaagtctgcgcgagggatcgcgccgctgcgcgagccgattggtattgaatactgaagggcactgg
cagcgccggacggggtatgcaaacatttgcatacaaaaccgtgtttctttcagtagcctttcattatcaatcggccctgggggattaaaccttgcatggc
gctgcctgacaatcagcctaacgtcgggaataaccctagcacctgcacagatatctccgcggcggcagcggcggcgcgttggcgaggcgagcggcgcaac
TTG

    BB3031 Gene: BB3031     GI: 33602007     BI number: BB3031     GOG: COG0488     Description: probable ATP-binding ABC transporter protei   g t  a        g ta       a  c at        cg ta        gc gc        gc gt        tg tg        cg        ca ta       a  a      a  t a  a      c  c       at g  g      g  g       at cg       g  g       cg cg       g  |       gc gc       a  |       ta |  a      a  |       at a  c      g  |       ta gt        tg        gc cg        cg       |  a g  |       at       |  a cg        ta       |  a gc        at       g  a ta       a  g       gc cg        gc        gc gc        ta        cg cg        ta        at                         gtttctttcagtagcctttcattatcaatcggccctgggggattaaaccttgcatggcgctgcctgacaatcagcctaacgtcgggaataaccctagcacctgcacagatatctccgcggcggcagcggcggcgcgttggcgaggcgagcggcgcaacTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................