                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGTTCGACAAGGTCAAGCAGGAACTTCTGTACGTGCCCGAGGTCATGGAATGCCAT
CTGGTCTCGGGCGATTTCGATTATCTGGTCAAGGCGCGGCTATCGGAAATGAATGAAT
ACCGCCGCTTGCTGGGCGAGATTCTCAAGCGCCTGCCCGCTTCGGCGGAATCGCACAG
CTACGTGGTCATGGAAGAAATCAAGGAAACCCTCTACCTGCCGGTGGACCGCTGAatcc
cgccgcccgccatgaatcggggacgcttcatcttttttctgtaccattctgagccgtatttcatttcATG

    BB3051 Gene: BB3051     GI: 33602027     BI number: BB3051     GOG: COG2928     Description: putative exported protei   c g  c c  c cg gc |  c c  a c  t cg        gg ta       g  a a  a       gc At        cg Gc       t  c Tg        at Cg        at G  |       gc Cg        ta Cg        at             cttttttctgtaccattctgagccgtatttcatttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2928 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................