                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-22.50 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-31.70 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-12.74 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTCGACGGCAAGAACACGGTGCGCACCAACGGCGTGCGGCACAAGAGCCGTCTGGA
CGGCGGTCGCGCCGAGCTGGACCTGGGCGTGGCTGCGCAACTGGGCAAGCACGGCAGC
CTGTACGGCTCGTACGAGTACGCCAAGGGCAGCCGCCAGACCATGCCGTGGACCTTCC
ACATCGGCTACCGCTACACCTGGTAGcggagatgcggcgcctgtcccggcaggcacaggcacaggcgccggagttttctgc
gcggcgattggcgcgcccggtgcgtgatgggttggtttcgctcaaGTG

    BB3110 Gene: BB3110     GI: 33602086     BI number: BB3110     GOG: COG3468     Description: autotransporte             C           C  T           A  G            CG            AT            TA            CG   C        Gc C  T       Cg A  T       Cg GC       A  a GC       T  | TA       C  | GC       G  | C  A      G  | C  T       Cg G  |       Ta T  |       At A  |       Cg C  |      A  c       gg C  |       Cg       a  c A  |       Cg       c  a G  |      |  c      g  c A  |      |  g      g  a C  |      T  c       cg C  |      T  c       cg GC       C  t      c  c CG        Cg        ta CG        At        gc GC        Gc        ta AT        Gc        cg C  A      T  |       cg GC        Gc        gc GC        Cg        cg |  G       Cg        gc GC        Gc        gc AT        Ta        cg                         gagttttctgcgcggcgattggcgcgcccggtgcgtgatgggttggtttcgctcaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MU] COG3468 Type V secretory pathway, adhesin AidA ... can be seen here     ..................................................................................................................