                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:209 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

accgttcgtgtaatttatcagggcttgagaggcttggctatagtcggttccgcgcttttccgacacgctgcgggtagcctggtgttttgtaaaaacgctt
ataaatcaaatagatatgttttcttttaaggtgtttttaagaaatctccctaatggtttcccctgattcgattcccggaagttgttgtaaaaaccgaatg
gtcggttggttataaaaatctgtacttgacatgccatcgcctcctcatttataaatcgaacgaccattcggattattaaataattcacaaaccatcggag
GTG

    BB3148 --- BB3147 --- BB3146 --- BB3145 --- BB3144 --- BB3143 Gene: BB3148     GI: 33602124     BI number: BB3148     GOG: COG4638     Description: putative dioxygenase hydroxylase component Gene: BB3147     GI: 33602123     BI number: BB3147     GOG: COG5517     Description: putative dioxygenase component Gene: BB3146     GI: 33602122     BI number: BB3146     GOG: COG1024     Description: enoyl-CoA hydratase/isomerase-like protein Gene: BB3145     GI: 33602121     BI number: BB3145     GOG: COG1028     Description: putative 3-oxoacyl-CoA or-ACP reductase Gene: BB3144     GI: 33602120     BI number: BB3144     GOG: COG0633     Description: putative ferredoxin Gene: BB3143     GI: 33602119     BI number: BB3143     GOG: COG1804     Description: putative fatty-acyl-CoA racemas            at           t  a            cg         c            gt       c  g            gc       t  a           t  |      t  c            tg       t  a            cg       t  c           g  |       cg ga        gt        gc t  g       at       |  t ta        gc        cg cg       a  |       gc g  g       gc        cg gc        tg        cg gt       t  c       tg at        cg       |  t G  g       gc       |  a Tg        gt        tg Gc        gt        gc gt        at        gc                         tggtgttttgtaaaaacgcttataaatcaaatagatatgttttcttttaaggtgtttttaagaaatctccctaatggtttcccctgattcgattcccggaagttgttgtaaaaaccgaatggtcggttggttataaaaatctgtacttgacatgccatcgcctcctcatttataaatcgaacgaccattcggattattaaataattcacaaaccatcggagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PR] COG4638 Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit ... can be seen here [Q] COG5517 Small subunit of phenylpropionate dioxygenase ... can be seen here [I] COG1024 Enoyl-CoA hydratase/carnithine racemase ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [C] COG0633 Ferredoxin ... can be seen here [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here     ..................................................................................................................