                                                                        Gene putatively regulated by attenuation in B_bronchiseptica

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.07 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-17.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAAAGCGCTGCGCAAGCTGCGCCACCCCAGCCGCGCCGACAAGCTGAAGAGCTTCCT
CGAAGGGCAGTAAacatttcctGGGCCTCTAGCTCATGCCTGGTTAGAGCAGCGGACTCAT
AATCCGTTGGTGCCGAGTTCGACTCTCGGGGGGCCTACCAaaaaggcctgagtattcaggcatttacagc
cgccagcaatggcggctgttttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactat
gaattcaattcATG

    BB3160 --- BB3159 Gene: BB3160     GI: 33602136     BI number: BB3160     GOG: COG4680     Description: putative membrane protein Gene: BB3159     GI: 33602135     BI number: BB3159     GOG: COG5499     Description: conserved hypothetical protei   G C  A T  C T  T GC AT GC CG CG |  G |  G       ta |  G      g  t |  G      a  t |  C       gc |  C       ta GT        cg TA        cg GC        gc GC       g  a TA       a  t Ta       a  t |  a      a  t |  a      a  a G  a      A  c       ca Cg       C  a      g  a Cg       C  |       at T  c      A  |       cg A  c      T  |       cg A  |      C  |       gc T  |       Cg        cg At        Gc        cg Cg        Gc        gc Ta       |  g       at Cg        Gc        cg At        Gc        at                         tttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactatgaattcaattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4680 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG5499 Predicted transcription regulator containing HTH domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_bronchiseptica                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.90 kcal/mol Antiterminator: Size=45 nt.     Delta G=-13.07 kcal/mol Anti-antiterminator:   Size=59 nt.     Delta G=-17.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CCAAAGCGCTGCGCAAGCTGCGCCACCCCAGCCGCGCCGACAAGCTGAAGAGCTTCCT CGAAGGGCAGTAAacatttcctGGGCCTCTAGCTCATGCCTGGTTAGAGCAGCGGACTCAT AATCCGTTGGTGCCGAGTTCGACTCTCGGGGGGCCTACCAaaaaggcctgagtattcaggcatttacagc cgccagcaatggcggctgttttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactat gaattcaattcATG     BB3160 --- BB3159 Gene: BB3160     GI: 33602136     BI number: BB3160     GOG: COG4680     Description: putative membrane protein Gene: BB3159     GI: 33602135     BI number: BB3159     GOG: COG5499     Description: conserved hypothetical protei   G C  A T  C T  T GC AT GC CG CG |  G |  G       ta |  G      g  t |  G      a  t |  C       gc |  C       ta GT        cg TA        cg GC        gc GC       g  a TA       a  t Ta       a  t |  a      a  t |  a      a  a G  a      A  c Cg       C  a Cg       C  | T  c      A  |       ca A  c      T  |      g  a A  |      C  |       at T  |       Cg        cg At        Gc        cg Cg        Gc        gc Ta       |  g       cg Cg        Gc        cg At        Gc        gc                         tgttttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactatgaattcaattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4680 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG5499 Predicted transcription regulator containing HTH domain ... can be seen here     ..................................................................................................................