                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-26.70 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-17.30 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTACCGAGAACGAACTGCTCAAGACCCCGAACCTGGGCCGCAAGTCGCTCAACGAG
ATCAAGGAAGTGCTGGCCGCACGCGGCCTGACCCTTGGCATGAAGCTGGAAAACTGGC
CCCCGCTGGGCCTCGAGCGCCCGTAAgcagtcaagcgcggtgggcgcgccatgcgcccgccgcgatgttttcatgcatcgg
aaggtgcatactttttccaccggaccgcggcctgtcacagaccgatagaagagccggataacccgatggcggaaacgccgtccttagattcaaaggaaat
atcATG

    BPP0058 Gene: BPP0058     GI: 33594779     BI number: BPP0058     GOG: COG0203     Description: 50S ribosomal protein L1   G C  C C  T CG        tc CG       g  a CG       a  a GC        cg GC        gc T  |      |  g C  |      A  c A  |      A  g A  |       Tg A  |       Gt         c AT        Cg       c  a GC        Cg       g  t G  G       Cg        cg TA        Gc        gc CG        Cg        cg GC        Gc        gc A  |      A  |       gc A  |      G  |       gc G  |      C  |       tg T  |      T  |       gc A  |      C  |       gc CG        Cg        cg GC        Gc        gc GC        Gc        cg                         atgttttcatgcatcggaaggtgcatactttttccaccggaccgcggcctgtcacagaccgatagaagagccggataacccgatggcggaaacgccgtccttagattcaaaggaaatatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0203 Ribosomal protein L17 ... can be seen here     ..................................................................................................................